View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13945_high_17 (Length: 245)

Name: NF13945_high_17
Description: NF13945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13945_high_17
NF13945_high_17
[»] chr4 (1 HSPs)
chr4 (65-227)||(5233019-5233185)


Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 65 - 227
Target Start/End: Complemental strand, 5233185 - 5233019
Alignment:
65 attgttgatgaaatatcttaatttttt---gtcaaaaaa-tactttgcaatctctttctagatttaacaaaagtttaaaattatgaccccccaatgacca 160  Q
    ||||||||||||||| ||||||||| |   ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5233185 attgttgatgaaatagcttaattttgtttggtcaaaaaaatactttgcaatctctttctagatttaacaaaagtttaaaattatgaccccccaatgacca 5233086  T
161 tcttatatgtgcaatttctccatttacatatttgtgacacatgtaacacatagttttacataattga 227  Q
    |||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||    
5233085 tcttatatgtgcaatttctccatttagacatttgtgacacatgtaacacatagttttacataattga 5233019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University