View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13945_high_20 (Length: 217)
Name: NF13945_high_20
Description: NF13945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13945_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 48535904 - 48535724
Alignment:
| Q |
19 |
aaaatttatgttcctttaggttctgtgagagggctcaagcactactacaggcagatctacacactagttcggtcatggttactcacgaattaactcaagt |
118 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |||||| |||| | ||||||||||||| |||| || |||||||| | |||| ||||||||| |
|
|
| T |
48535904 |
aaaatttatgttcattcaggttctgtgagagggctcaggcactaatacatggagatctacacactggttctgtgatggttacacgtgaatcaactcaagt |
48535805 |
T |
|
| Q |
119 |
tattgatcctgaatttgcattttatggaccaatgggttttgatattggagcattccttggtaacttgatattggctttctt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||| ||||||||||| |
|
|
| T |
48535804 |
tattgatcctgaatttgcattttatggaccaatgggttttgatatcggagcattcctaggaaacttgattttggctttctt |
48535724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University