View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13945_low_15 (Length: 271)

Name: NF13945_low_15
Description: NF13945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13945_low_15
NF13945_low_15
[»] chr4 (1 HSPs)
chr4 (24-148)||(56442870-56442989)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 24 - 148
Target Start/End: Original strand, 56442870 - 56442989
Alignment:
24 acggaaacgacaatgagcagcagcatctcactcctatcgctgctgctgccatcacccctcactccttgccacgttgcagatttacttggattggattgga 123  Q
    ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||     ||||||||||    
56442870 acggaaacgacaatgagcagcagcacctcactcctatcgctactgctgccatcacccctcactctttgccacgttgcaaatttac-----ttggattgga 56442964  T
124 ttggattcatgcattgcatacttca 148  Q
    |||||||||||||||||||||||||    
56442965 ttggattcatgcattgcatacttca 56442989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University