View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13945_low_16 (Length: 251)
Name: NF13945_low_16
Description: NF13945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13945_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 24 - 240
Target Start/End: Complemental strand, 33114707 - 33114492
Alignment:
| Q |
24 |
agaatcaattttacacctataaaatcaattgatcataatcggagaaaccaaaatatacacacataaacttcacccatctgtcgttcttggaagtttgaac |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33114707 |
agaatcaattttacacctataaaatcaattgatcataatcggagaaaccaaaatatacacacagaaacttcacccatctgccgttcttggaagtttgaac |
33114608 |
T |
 |
| Q |
124 |
cttgaagcttaatttgtttgaactttgaagtttcaattgnnnnnnnnntactggtcttctggaattatatataactcagtcctttcatgtgtcagtacaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33114607 |
cttgaagcttaatttgtttgaactttgaagtttcaattg-aaaaaaaatactggtcttctggaattatatataactcagtcctttcatgtgtcagtacaa |
33114509 |
T |
 |
| Q |
224 |
aacaccacctcgttcat |
240 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33114508 |
aacaccacctcgttcat |
33114492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University