View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13945_low_18 (Length: 245)
Name: NF13945_low_18
Description: NF13945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13945_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 65 - 227
Target Start/End: Complemental strand, 5233185 - 5233019
Alignment:
| Q |
65 |
attgttgatgaaatatcttaatttttt---gtcaaaaaa-tactttgcaatctctttctagatttaacaaaagtttaaaattatgaccccccaatgacca |
160 |
Q |
| |
|
||||||||||||||| ||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5233185 |
attgttgatgaaatagcttaattttgtttggtcaaaaaaatactttgcaatctctttctagatttaacaaaagtttaaaattatgaccccccaatgacca |
5233086 |
T |
|
| Q |
161 |
tcttatatgtgcaatttctccatttacatatttgtgacacatgtaacacatagttttacataattga |
227 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5233085 |
tcttatatgtgcaatttctccatttagacatttgtgacacatgtaacacatagttttacataattga |
5233019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University