View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13946_high_22 (Length: 334)
Name: NF13946_high_22
Description: NF13946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13946_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 322
Target Start/End: Complemental strand, 3157998 - 3157693
Alignment:
| Q |
18 |
ctattatgttgatatttctactttctgtgatggctcgtgggttcaaattatattcaccaagataaattcaaacatctctttaatacattatttattgatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3157998 |
ctattatgttgatatttctactttctgtgatggctcgtgggttcaaattatattcaccaagataaattcaaacatctctttaatatattatttattgatt |
3157899 |
T |
 |
| Q |
118 |
tatgttcatttattggccagtaatattacttgaattttgaaaataaaataaag-aattatatttgtataaaatttttggacaattttatctcttatatac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3157898 |
tatgttcatttattggccagtaatattacttgaattttgaaaataaaataaagaaattatatttgtataaaatttttggacaattttatctcttatacac |
3157799 |
T |
 |
| Q |
217 |
ggattgtgtttttatttcatctcttcnnnnnnnnncctctcaattttaccaacattgtctttattaaatgaaaattatattaatgtcatttcatagttat |
316 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
3157798 |
ggattgtgtttttatttcatctcttctttttttttcctctcaattttacctacattgtctttattaaaagaaaattatattaatgccatttcatagttat |
3157699 |
T |
 |
| Q |
317 |
catatt |
322 |
Q |
| |
|
|||||| |
|
|
| T |
3157698 |
catatt |
3157693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University