View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13946_high_33 (Length: 230)
Name: NF13946_high_33
Description: NF13946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13946_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 4793089 - 4793277
Alignment:
| Q |
17 |
atataccataggaagcatgtaataatacatgaaaacaaatgtgaatgcaaccacgggcggcattgccgagatcggcaccggtgaatagagaaaacctgcg |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4793089 |
atataccataggaagcatgtaat---acatgaaaactaatgtgaatgcaaccacgggcggcattgccgagatcggcaccggtgaatagagaaaacctgcg |
4793185 |
T |
 |
| Q |
117 |
atttaattaagnnnnnnnttattactttaaatgaatgcaaaatccaatcgctctttaacattttcacttcctttaatttctatcatttcctttgttt |
213 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4793186 |
atttaattaagaaaaaaattattactttaattgaatgcaaaatccaatcgctctttaacattttcacttcc-----tttctatcatttcctttgttt |
4793277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University