View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13946_high_35 (Length: 227)
Name: NF13946_high_35
Description: NF13946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13946_high_35 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 5435984 - 5436204
Alignment:
| Q |
7 |
ggactttggtgtcctatcattacctcctccttcaaaattaaccctgtcctcaaggctaccatgaagaccttgatccttcnnnnnnnccaagttctccact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5435984 |
ggactttggtgtcctatcattacctcctccttcaaaattaaccctgtcttcaaggctaccatgaagaccttgatccttcaaaaaaaccaagttctccact |
5436083 |
T |
 |
| Q |
107 |
tatgttttctttatttccttctttccttgtgactttaattggctgttgcagtgctttcacgatagctcgttttttctgcctcgtttaattttccaatcct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5436084 |
tatgttttctttatttccttctttccttgtgactttaattggctgttgcagtgctttcacgatagctcgttttttccgcctcgtttaattttccaatcct |
5436183 |
T |
 |
| Q |
207 |
tgaggatttgaccttgcagct |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5436184 |
tgaggatttgaccttgcagct |
5436204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University