View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13946_high_40 (Length: 213)
Name: NF13946_high_40
Description: NF13946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13946_high_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 35790850 - 35790646
Alignment:
| Q |
1 |
caactttgcttctggtgcttctggctactttgatcctacagccaagctttatgtaannnnnnnnnnnnttatcatgtttaaagcaaaacaaaaatattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35790850 |
caactttgcttctggtgcttctggctactttgatcctacagccaagctttatgtaaatatatatat--ttatcatgtttaaagcaaaacaaaaatattat |
35790753 |
T |
 |
| Q |
101 |
ttttttctacataactttgatcatattggttaatcctaatttgttttcttctttaacttgttccatttgggtctagcatgcaatctcattggagcagcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35790752 |
ttttttctacataactttgatcatattggttaatcctaatttgttttcttctttaacttgttccatttgggtctagcatgcaatctcattggagcagcag |
35790653 |
T |
 |
| Q |
201 |
ctggaac |
207 |
Q |
| |
|
||||||| |
|
|
| T |
35790652 |
ctggaac |
35790646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University