View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13946_low_24 (Length: 314)
Name: NF13946_low_24
Description: NF13946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13946_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 42570912 - 42571173
Alignment:
| Q |
1 |
atccaggagccaggtggtgctttggatagtatcaagctaactttgttcatcaacttgactttagtacattttttaaggatgtcagatccctgatagaaaa |
100 |
Q |
| |
|
||||| || |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42570912 |
atccatgatccagttggtgctttggataggatcaagctaactttgttcatcaacttgactttagtacattttttaaggatgtcagatcactgatagaaaa |
42571011 |
T |
|
| Q |
101 |
agaggcacaaatggcaagaaaccgctaggtattattagtctcaactagatatcaacaagtctgctgaattatgcagcagtggctagctaaaaattaaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42571012 |
agaggcacaaatggcaagaaaccgctaggtattattagtctcaactagatatcaacaagtctgctgaattatgcagcagtggctagct-aaaattaaact |
42571110 |
T |
|
| Q |
201 |
agagaagagatgacgacgcatgatagttgtcggaactgcaaccaccctcacaacactaacccc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42571111 |
agagaagagatgacgacgcatgatagttgtcggaactgcaaccgccctcacaacactaacccc |
42571173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 127 - 167
Target Start/End: Original strand, 42578233 - 42578273
Alignment:
| Q |
127 |
aggtattattagtctcaactagatatcaacaagtctgctga |
167 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42578233 |
aggtattattagtctcaactagatatcatcaagtctgctga |
42578273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 268 - 307
Target Start/End: Original strand, 42571155 - 42571194
Alignment:
| Q |
268 |
ccctcacaacactaaccccttacaaagtgcatattcttgg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42571155 |
ccctcacaacactaaccccttacaaagtgcattttcttgg |
42571194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University