View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13946_low_38 (Length: 223)
Name: NF13946_low_38
Description: NF13946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13946_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 176
Target Start/End: Complemental strand, 45104688 - 45104526
Alignment:
| Q |
14 |
agggacattcaagttcaacttcccaccgatcgcttctgtagcaaccaaattacgtttaattccgagattatggctcttgaatttggttaatgttgaagaa |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45104688 |
agggaaattcaagttcaacttcccaccgatcgcttctgtagaaaccaaattacgtttaattccgagattatggctcttgaatttggttaatgttgaagaa |
45104589 |
T |
|
| Q |
114 |
gatgatgatcgggaattgaatttaggtttaggaagtaacggttttacgcgggaaaatgaatgt |
176 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45104588 |
gatgatgaacgggaattgaatttaggtttcggaagtaacggttttacgcgggaaaatgaatgt |
45104526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University