View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13946_low_39 (Length: 221)
Name: NF13946_low_39
Description: NF13946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13946_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 79 - 204
Target Start/End: Complemental strand, 23891884 - 23891756
Alignment:
| Q |
79 |
agaatcaattgaaagcaaaacatataatcaaaattggagtcatagtcttctatcttcgttttgtataatcaccggaggtt---tnnnnnnntcttttgaa |
175 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
23891884 |
agaatcaattgaaagcaaaacagatcatcaaaattggagtcatagtcttctatcttcgttttgaataaataccggaggttaaaaaaaaatatcttttgaa |
23891785 |
T |
|
| Q |
176 |
ccttctactgtcaatttacacccaatttt |
204 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |
|
|
| T |
23891784 |
ccttctaatgtcaatttccacccaatttt |
23891756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 79 - 134
Target Start/End: Complemental strand, 30801591 - 30801536
Alignment:
| Q |
79 |
agaatcaattgaaagcaaaacatataatcaaaattggagtcatagtcttctatctt |
134 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
30801591 |
agaatcaattgaaagcaaaacagatcatcaaaattggagtcatagtcttctatctt |
30801536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University