View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13947_high_12 (Length: 289)
Name: NF13947_high_12
Description: NF13947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13947_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 20 - 279
Target Start/End: Complemental strand, 41653815 - 41653551
Alignment:
| Q |
20 |
ctgaggattctgcaagttgaagacaatgagattcctatcagcagttcctacaaccatgagaggatgtctcacatccattgtacagcagagatcagggagt |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653815 |
ctgaggattctgcaagttgaagacaataagattcctatcagcagttcctacaaccatgagaggatgtctcacatccattgtacagcagagatcagggagt |
41653716 |
T |
 |
| Q |
120 |
tgctgagtatgcactggattttgctgcctagtatcccaatacctaataaacacaaaataatttgtgaaatgacccaagactctttggac----------- |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||| ||||||| ||| |
|
|
| T |
41653715 |
tgctgagtatgcactggattttgctgcctagtatcccaatacctaacaaacataaaataa----------gacccaatactctttagacgtacgtacggt |
41653626 |
T |
 |
| Q |
209 |
----gaataaaaagaatgaatatgcatacttaatggttttgtcccagcttcctgtggccaaaacattcatctctg |
279 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653625 |
aactgaatgaaaagaatgaatatgcatgcttaatggttttgtcccagcttcctgtggccaaaacattcatctctg |
41653551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 20 - 165
Target Start/End: Original strand, 28818038 - 28818183
Alignment:
| Q |
20 |
ctgaggattctgcaagttgaagacaatgagattcctatcagcagttcctacaaccatgagaggatgtctcacatccattgtacagcagagatcagggagt |
119 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||| |||||||||||||| ||||||| | || ||||||||||| |
|
|
| T |
28818038 |
ctgaggattctgcaagttgaagacaatcagattcctatcggcagttcccacaaccatcagaggatgtctcactgacattgtataacatcgatcagggagt |
28818137 |
T |
 |
| Q |
120 |
tgctgagtatgcactggattttgctgcctagtatcccaatacctaa |
165 |
Q |
| |
|
|| |||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
28818138 |
tgttgagtatgcactgggttggattgcctagtatcccaatacctaa |
28818183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 165
Target Start/End: Original strand, 1463520 - 1463665
Alignment:
| Q |
20 |
ctgaggattctgcaagttgaagacaatgagattcctatcagcagttcctacaaccatgagaggatgtctcacatccattgtacagcagagatcagggagt |
119 |
Q |
| |
|
||||||||| ||||| ||| | ||||| | ||| ||||||||||| || || ||||| ||||||||| |||| ||||| | ||||| | || |||||| |
|
|
| T |
1463520 |
ctgaggattttgcaaattgtaaacaataatatttctatcagcagtgccaactaccatcagaggatgtttcactgtcattgcatagcagcgctctgggagt |
1463619 |
T |
 |
| Q |
120 |
tgctgagtatgcactggattttgctgcctagtatcccaatacctaa |
165 |
Q |
| |
|
|| || || |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
1463620 |
tgttgtgtgtgcactggatttggctgccttgtatcccaatacctaa |
1463665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University