View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13947_low_19 (Length: 213)
Name: NF13947_low_19
Description: NF13947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13947_low_19 |
 | |
|
| [»] scaffold0349 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 80 - 182
Target Start/End: Complemental strand, 29262720 - 29262621
Alignment:
| Q |
80 |
ctttaaaatgtaacttgatcaactattttcttcccaagttccatgaactcgagagaggaaaggaacaaaactacttgtttaatatgagttacgtttttat |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||| |
|
|
| T |
29262720 |
ctttaaaatgtaacttgatcaactattttcttcccaagttccatgaactcgagagaggaaaggaaataaacta---gtttcatatgagttacgtttttat |
29262624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 94 - 188
Target Start/End: Complemental strand, 27613279 - 27613189
Alignment:
| Q |
94 |
ttgatcaactattttcttcccaagttccatgaactcgagagaggaaaggaacaaaactacttgtttaatatgagttacgtttttatgctcgagag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| || |||||||||||||| ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
27613279 |
ttgatcaactattttcttcccaagttccatgagctc--gacaggaaaggaacaaatttacttattta--atgagttacgtttttatgctcgagag |
27613189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 16 - 84
Target Start/End: Complemental strand, 27707888 - 27707820
Alignment:
| Q |
16 |
attattcttctttgggtgaaactgtgaaagcagatatcgaatctgtatttgttatagtacagcgcttta |
84 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| |||||||||| ||||||||||||| |||||| |
|
|
| T |
27707888 |
attattcttttttgggtgaaactgtgaaagcggatattgaatctgtatctgttatagtacagtgcttta |
27707820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 27727700 - 27727646
Alignment:
| Q |
30 |
ggtgaaactgtgaaagcagatatcgaatctgtatttgttatagtacagcgcttta |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||||||||| |||||| |
|
|
| T |
27727700 |
ggtgaaactgtgaaagcggatattgaatctgtatctgttatagtacagtgcttta |
27727646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0349 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0349
Description:
Target: scaffold0349; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 6279 - 6225
Alignment:
| Q |
30 |
ggtgaaactgtgaaagcagatatcgaatctgtatttgttatagtacagcgcttta |
84 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||||||||| |||||| |
|
|
| T |
6279 |
ggtgaaactgtgaaagcggatattgaatctgtatctgttatagtacagtgcttta |
6225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 3062072 - 3062010
Alignment:
| Q |
114 |
caagttccatgaactcgagagaggaaaggaacaaaactacttgtttaatatgagttacgtttt |
176 |
Q |
| |
|
|||||||| ||||| ||| |||||||||||||||||| ||||||||||||||| |||| |||| |
|
|
| T |
3062072 |
caagttccttgaacccgaaagaggaaaggaacaaaacgacttgtttaatatgaattacatttt |
3062010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University