View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13947_low_9 (Length: 322)
Name: NF13947_low_9
Description: NF13947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13947_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 162 - 302
Target Start/End: Complemental strand, 47563271 - 47563131
Alignment:
| Q |
162 |
acaaaacatggggttgtgctttggttgcttcgacggaggcaacaagcgtatgacaaaggaggaagaaagattagcctctgaagaagcacgcgctagagct |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47563271 |
acaaaacatggggttgtgctttggttgcttcgacggaggcaacaagcgtatgacaaaggaggaagaaagattagcctctgaagaagcacgcgctagagct |
47563172 |
T |
 |
| Q |
262 |
gctgaagccgcccagaaaaagtatgtttccttagtaatttt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47563171 |
gctgaagccgcccagaaaaagtatgtttccttagtaatttt |
47563131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 47563425 - 47563372
Alignment:
| Q |
16 |
atagaagggaagaaaaactccaacgaaaaagggaaggatacggttttcttgttc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47563425 |
atagaagggaagaaaaactccaacgaaaaagggaaggatacagttttcttgttc |
47563372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 280
Target Start/End: Original strand, 5156721 - 5156823
Alignment:
| Q |
178 |
tgctttggttgcttcgacggaggcaacaagcgtatgacaaaggaggaagaaagattagcctctgaagaagcacgcgctagagctgctgaagccgcccaga |
277 |
Q |
| |
|
|||||||||||||||| || || ||||||| ||||| || || |||||| ||||||||||||||||||| || |||||||||||||||||||| |||| |
|
|
| T |
5156721 |
tgctttggttgcttcggtggtggtgacaagcgcatgaccaaagaagaagaacgattagcctctgaagaagcgcgtgctagagctgctgaagccgctcaga |
5156820 |
T |
 |
| Q |
278 |
aaa |
280 |
Q |
| |
|
||| |
|
|
| T |
5156821 |
aaa |
5156823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University