View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13948_high_30 (Length: 238)
Name: NF13948_high_30
Description: NF13948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13948_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 221
Target Start/End: Complemental strand, 53154297 - 53154089
Alignment:
| Q |
14 |
tactaggcttgcaacttgtgtcggcgtaatatatcggttcttttattattggacctaaatccaaatcctaaataattaaacatttataccatctagtcta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53154297 |
tactaggcttgcaacttgtgtcggcgtaatatatcggttgttttattattggacctaaatccaaatcctaaataattaaacatttataccatctagtcta |
53154198 |
T |
 |
| Q |
114 |
gcacaacgattcacaatca-tttggcaacttggctatcacaaatattattttcaaataataacaatggcaacatactccttcacggaaaattcttaaatg |
212 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53154197 |
gcacaacgactcacaatcattttggcaacttggctatcacaaatattattttcaaataataacaatggcaacatactccttcacggaaaattcttaaatg |
53154098 |
T |
 |
| Q |
213 |
gacacaaac |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
53154097 |
gacacaaac |
53154089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University