View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13948_high_33 (Length: 235)
Name: NF13948_high_33
Description: NF13948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13948_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 33814717 - 33814516
Alignment:
| Q |
19 |
atctgactgttgtttggttagagagtgaacaattggctactcagcttggctacaaatgttctcatgcatttcttgaggggaatatggttgcagacgcttt |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33814717 |
atctgagtgttgtttggttagagagtgaacaattggctactcagcttggctacaaatgttctcatgcatttcttgaggggaatatggttgcggacgcttt |
33814618 |
T |
 |
| Q |
119 |
gac-aaaaaacggacaggggttggctctttgcacatcacaatggtggaatgacccaccacagtttattctttctttgttaaatagagagcaaataggttt |
217 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33814617 |
ggcaaaaaaacggacaggggttggctctttgcacatcacaatggtggaatgacccaccacagtttattctttctttgttaaatagaaagcaaataggttt |
33814518 |
T |
 |
| Q |
218 |
ac |
219 |
Q |
| |
|
|| |
|
|
| T |
33814517 |
ac |
33814516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University