View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13948_high_9 (Length: 415)
Name: NF13948_high_9
Description: NF13948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13948_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 37916586 - 37916312
Alignment:
| Q |
1 |
ccagccgaattttgagcataatgtattccaaaacaatattatacaagaggaactagctcatactggtacttcccatactgagaacccccttccccagcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37916586 |
ccagccgaattttgagcataatgtattccaaaacaatattatacaagaggaactagctcatactgatacttcccatactgagaacccccttccccagcac |
37916487 |
T |
 |
| Q |
101 |
--------cgctacccggtgcttcagaatgtcttggaattgcttcgtcaaataagggctatgaaaaatgacgcttcaaacgaacattttacttctcattt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37916486 |
ggcagcaccgctacccggtgcttcagaatgtcttggaattgcttcgtcaaataagggctacgaaaaatgacgcttcaaacgaacattttactcctcattt |
37916387 |
T |
 |
| Q |
193 |
gtcgaagaagcagaagaaacaactcaccaaagtcactacacacaacatccgttccaagggcgactgaggagcata |
267 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37916386 |
gttgaagaagcagaagaaacaactcaccaaagtcactacacacaacacccgttccaagggcgactgaggagcata |
37916312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 363 - 414
Target Start/End: Complemental strand, 37916215 - 37916164
Alignment:
| Q |
363 |
gaggtgccaatcttgttagatgtctgagtctcctcttaatgtatttcctttc |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37916215 |
gaggtgccaatcttgttagatgtctgagtctcctcttaatgtatttcctttc |
37916164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University