View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13948_low_16 (Length: 373)
Name: NF13948_low_16
Description: NF13948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13948_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 20 - 366
Target Start/End: Original strand, 25825246 - 25825592
Alignment:
| Q |
20 |
ttgccttcaacaattcacctgcttctgaattaaaacacttcttttcagacgaagaagccttaaaccgatgcgaagtattggtgatttcttgaagtttatt |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25825246 |
ttgccttcaacaactcacctgcttctgaatcaaaacacttcttttcagacgaagaagccttaaaccgatgcgaagtattggtgatttcttgaagtttatt |
25825345 |
T |
|
| Q |
120 |
agaaacccttttgctcactttctcatcacaaacattctctcccttgttcttcttctccttcaattctgaacaactcattttcttttttctcccacttgat |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25825346 |
agaaacccttttgctcattttctcatcacaaacaatctctctcttgttcttcttctccttcaattctgaacaactcattttcttttttctcccatttgat |
25825445 |
T |
|
| Q |
220 |
ttcaaccctttaccactctcaccttcatttccaaaactaagcacaaaaaagctctcattttcactcatttgaaaagttggtggctctctaaaagacaatg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25825446 |
ttcaaccctttaccactctcaccttcatttccaaaactaagcacaaaaaagctctcattttcactcatttgaaaagttggtggctctctaaaagacaatg |
25825545 |
T |
|
| Q |
320 |
ttgaaccaactctcttatgatgcaaactctcaatcttccctttgctt |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25825546 |
ttgaaccaactctcttatgatgcaaactctcaatcttcccattgctt |
25825592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University