View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13948_low_23 (Length: 311)
Name: NF13948_low_23
Description: NF13948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13948_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 36891219 - 36891521
Alignment:
| Q |
1 |
ttatattatttcttctctatagggttgatggccactctattcggtatgcgataaaaatggattctaatgccatcggtcttccnnnnnnnnnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36891219 |
ttatattatttcttctctatagggttgatggccactctattcggtatgcgataaaaatggattctaatgccatcggtcttccttttttatgtttaatttt |
36891318 |
T |
|
| Q |
101 |
nnngctttattcctttgattgatgcttaactaactgatacatgatttaatgtgtcttcactgatacaacatcatagatatttgttccccaaaagggataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36891319 |
tttgctttattcctttgattgatgcttaactaactgatacatgatttaatgtgtcttcactgatacaacatcatagatatttgttccccaaaagggataa |
36891418 |
T |
|
| Q |
201 |
taacttaacttgagcatgtaaaaagaaggaattagcttatgtcataagcttatatatatagcctttttgtaactttaggttattacatgaaatttgcatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36891419 |
taacttaacttgagcatgtaaaaagaaggaattagcttatgtcataagcttatatatatagcctttttgtaactttaggttattacatgaaatttgcatg |
36891518 |
T |
|
| Q |
301 |
tct |
303 |
Q |
| |
|
||| |
|
|
| T |
36891519 |
tct |
36891521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 221
Target Start/End: Original strand, 36899683 - 36899716
Alignment:
| Q |
188 |
ccaaaagggataataacttaacttgagcatgtaa |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
36899683 |
ccaaatgggataataacttaacttgagcatgtaa |
36899716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University