View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13948_low_26 (Length: 294)
Name: NF13948_low_26
Description: NF13948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13948_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 9 - 288
Target Start/End: Complemental strand, 11937563 - 11937285
Alignment:
| Q |
9 |
attatacttaactcgaccgggttgaggttttttgccaccgatcatgccttattgctcttggttgtgcttgttgcatttgcgtgttgcctacatactctga |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11937563 |
attacacttaactcgaccgggttgaggttttt-gccaccgatcatgccttattgctcttggttgtgcttgttgcatttgcgtgttgcctacatgctctga |
11937465 |
T |
 |
| Q |
109 |
gttgcctgcagactgggctaaaacattatgtgtgtgttgatgtgttggacgagtttgctgccatccactcatccatgatatgtcgagctctataaaccac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
11937464 |
gttgcctgcagactgggctaaaacattatgtgtgtgttgatgtgttggacgagtttgttgccatccactcatccatgatatgtcgagctctatcaatcac |
11937365 |
T |
 |
| Q |
209 |
atgtgcacaaagttcattttcattttgcgaaagttttaagttaggatgattccatatgctccacaataatgcaaccatct |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11937364 |
atgtgcacaaagttcattttcattttgcgaaagttttaagttaggatgattccatatgctccacaataatgcaaccatct |
11937285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University