View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13948_low_32 (Length: 248)

Name: NF13948_low_32
Description: NF13948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13948_low_32
NF13948_low_32
[»] chr3 (1 HSPs)
chr3 (1-241)||(2115111-2115351)


Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 2115351 - 2115111
Alignment:
1 atccgaatcttattcgcttctgcaagtggcttaaatctgagcttgagcttcaaggcattgattgtttacttgctgatagatcaaagtattcagatattca 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
2115351 atccgagtcttattcgcttctgcaagtggcttaaatctgagcttgagcttcaaggcattgattgtttgcttgctgatagatcaaagtattcagatattca 2115252  T
101 aagccatgaaattgctgatagagtcatttgctcggtcgcgtttggtttggtgatcgtcacaagttcaagtttcctcaaccgtttaagcatggaagaggtg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2115251 aagccatgaaattgctgatagagtcatttgctcggtcgcgtttggtttggtgatcgtcacaagttcaagtttcctcaaccgtttaagcatggaagaggtg 2115152  T
201 agattctttgctcaaaagaagaacttgattccgatattctt 241  Q
    |||||||||||||||||||||||||||||||||||||||||    
2115151 agattctttgctcaaaagaagaacttgattccgatattctt 2115111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University