View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13948_low_35 (Length: 236)
Name: NF13948_low_35
Description: NF13948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13948_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 220
Target Start/End: Complemental strand, 1841398 - 1841189
Alignment:
| Q |
11 |
gagtgagatgaaaataaatcaacaaaatagagtgaagagaggtagaagcagttcacagtgtattgatcatataatggcagagagaaaacgaagacaggag |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1841398 |
gagtgaaatgaaaataaatcaacaaaatggagtgaagagaggtagaagcagttcacagtgtattgatcatataatggcagagagaaaacgaagacaggag |
1841299 |
T |
 |
| Q |
111 |
ttgtctgagaaattcattgcactttcagccactattcccggcttgagcaaggtaaatttgtcactagtttcatcgggtccattattcgtataacatattt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
1841298 |
ttgtctgagaaattcattgcactttcagccactattcccggcttgagcaaggtaaatttgtcactagtttcatcggatccattattcgtataatatattt |
1841199 |
T |
 |
| Q |
211 |
tgatcatatt |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
1841198 |
tgatcatatt |
1841189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 40 - 176
Target Start/End: Complemental strand, 1824048 - 1823912
Alignment:
| Q |
40 |
gagtgaagagaggtagaagcagttcacagtgtattgatcatataatggcagagagaaaacgaagacaggagttgtctgagaaattcattgcactttcagc |
139 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| | ||||| || |||||||| ||||||||||||||||| || |
|
|
| T |
1824048 |
gagtgaagaaaggtagaagcagttcacaatgtattgatcatataatggcagagagaaaaaggagacaagaattgtctgaaaaattcattgcactttcggc |
1823949 |
T |
 |
| Q |
140 |
cactattcccggcttgagcaaggtaaatttgtcacta |
176 |
Q |
| |
|
|||||||| || ||||||||||||||||||| |||| |
|
|
| T |
1823948 |
tactattcctggattgagcaaggtaaatttgtaacta |
1823912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University