View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13948_low_39 (Length: 229)
Name: NF13948_low_39
Description: NF13948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13948_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 212
Target Start/End: Original strand, 47897434 - 47897626
Alignment:
| Q |
20 |
tatagcttaaaagagtgtcaactttacccttctttttcactgttatattttcatcttcataagaaatgcggcaaattcaaaaagggcaacacttatatgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47897434 |
tatagcttaaaagagtgtcaactttacccttctttttcactgttatattttcatcttcataagaaatgcggcaaattcaaaaagggcaacacttatatgc |
47897533 |
T |
|
| Q |
120 |
aatgtatgttctttatgttcctgcatttaatttttgtccattcaaatatccaagcaaaatacgttgatttctttgcttatgctcaaattgtct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47897534 |
aatgtatgttctttatgttcctgcatttaagttttgtccattcaaatatccaagcaaaatacgttgatttctttgcttatgctcaaattgtct |
47897626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University