View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13949_high_13 (Length: 239)

Name: NF13949_high_13
Description: NF13949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13949_high_13
NF13949_high_13
[»] chr3 (2 HSPs)
chr3 (1-65)||(50151875-50151939)
chr3 (143-222)||(50152017-50152097)


Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 50151875 - 50151939
Alignment:
1 tttgagcacaaatttcattacaatgattaagattacaataaaaccctttgatttatttggatgag 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50151875 tttgagcacaaatttcattacaatgattaagattacaataaaaccctttgatttatttggatgag 50151939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 143 - 222
Target Start/End: Original strand, 50152017 - 50152097
Alignment:
143 ggtggcaagctaagaaaaaact-ttcgagcagtgaaagggatagtgtctagtggttcagactacactaacttgaggtacct 222  Q
    ||||||||||||||||||||   ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
50152017 ggtggcaagctaagaaaaaaaaattcgagcggtgaaagggatagtgtctagtggttcagactacactaacttgaggtacct 50152097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University