View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13949_high_14 (Length: 230)
Name: NF13949_high_14
Description: NF13949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13949_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 45664087 - 45663892
Alignment:
| Q |
17 |
tgaacatttgttaatgctggttgatcacgtggaatagacacaaagattgatgtgaacctcaaataaaattgacggtcccaactgaatcatgaaattagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45664087 |
tgaacatttgttaatgctggttgatcacgtggaatagacacaaagattgatgtgaacctcaaataaaattgacggtcccaaccgaatcatgaaattagta |
45663988 |
T |
|
| Q |
117 |
ataattataacagtacgtacgtgtgataacggtagtgcatgtgatagcatcgactgaatcgaatcacatgcgtgatgcataattctttttagaggg |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45663987 |
ataattataacagtacgtacttgtgataacggtagtgcatgtgatagcatcgactgaatcgaatcacatgcgtgatgcataattctttttagaggg |
45663892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University