View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13949_low_14 (Length: 239)
Name: NF13949_low_14
Description: NF13949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13949_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 50151875 - 50151939
Alignment:
| Q |
1 |
tttgagcacaaatttcattacaatgattaagattacaataaaaccctttgatttatttggatgag |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50151875 |
tttgagcacaaatttcattacaatgattaagattacaataaaaccctttgatttatttggatgag |
50151939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 143 - 222
Target Start/End: Original strand, 50152017 - 50152097
Alignment:
| Q |
143 |
ggtggcaagctaagaaaaaact-ttcgagcagtgaaagggatagtgtctagtggttcagactacactaacttgaggtacct |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50152017 |
ggtggcaagctaagaaaaaaaaattcgagcggtgaaagggatagtgtctagtggttcagactacactaacttgaggtacct |
50152097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University