View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13949_low_16 (Length: 226)
Name: NF13949_low_16
Description: NF13949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13949_low_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 226
Target Start/End: Complemental strand, 48159718 - 48159513
Alignment:
| Q |
21 |
aatatagatatagaatgtatatggcaacattgggtgcaaattcaaatattataattaaaaatgatataagatttcgccgaacaacaacaacaaggttggc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159718 |
aatatagatatagaatgtatatggcaacattgggtgcaaattcaaatattataattaaaaatgatataagatttcgccgaacaacaacaacaaggttggc |
48159619 |
T |
 |
| Q |
121 |
agtgttcaaagtattgcctacacgattgcatttcttaagacatgatcgtaattctcatggtttggtggcatgccaatgtcaacaccacctccacaaaggg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
48159618 |
agtgttcaaagtattgcctacacgattgcatttcttaagacatgatcgtaattctcgtggtttggtggtatgccaatgtcaacaccaccaccacaaaggg |
48159519 |
T |
 |
| Q |
221 |
aaacca |
226 |
Q |
| |
|
|||||| |
|
|
| T |
48159518 |
aaacca |
48159513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University