View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1394_high_11 (Length: 411)
Name: NF1394_high_11
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1394_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 251; Significance: 1e-139; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 137 - 403
Target Start/End: Complemental strand, 14821915 - 14821649
Alignment:
| Q |
137 |
ggaacgaacagtattactgtaccctttgttcttctttctaatctgaaaccctataaacataaagcgctcaagccatcaccgaacccgcagccctagttca |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14821915 |
ggaaagaacagtattactgtaccctttgttcttctttctaatctgaaaccctagaaacataaagcgctcaagccatcaccgaaaccgcagccctagttca |
14821816 |
T |
 |
| Q |
237 |
ctgccaatgaaaaggaagaggataacttcttctctccaatcttcttcacagcaaattattttatatttacccgatgattgttgggaatctatcttcaaat |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14821815 |
ctgccaatgaaaaggaagaggataacttcttctctccaatcttcttcacagcaaattattttatatttacccgatgattgttgggaatctatcttcaaat |
14821716 |
T |
 |
| Q |
337 |
tcattatcaacaacaatgacgaaaacagcttgaaatgtctctccctcgtctccaagcagttcatctc |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14821715 |
tcattatcaacaacaatgacgaaaacagcttgaaatgtctctccctcgtctccaagcagttcctctc |
14821649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 6417626 - 6417578
Alignment:
| Q |
299 |
atatttacccgatgattgttgggaatctatcttcaaattcattatcaac |
347 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
6417626 |
atatttacccgatgagtgttgggaacttatcttcaaattcatcatcaac |
6417578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 299 - 345
Target Start/End: Complemental strand, 19633475 - 19633429
Alignment:
| Q |
299 |
atatttacccgatgattgttgggaatctatcttcaaattcattatca |
345 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
19633475 |
atatttacctgatgagtgttgggaatctatcttcgaattccttatca |
19633429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 228 - 286
Target Start/End: Original strand, 20477023 - 20477081
Alignment:
| Q |
228 |
cctagttcactgccaatgaaaaggaagaggataacttcttctctccaatcttcttcaca |
286 |
Q |
| |
|
||||||||| |||||||||||||||||| || | ||||||||||| ||||||||||||| |
|
|
| T |
20477023 |
cctagttcaatgccaatgaaaaggaagatgacagcttcttctctcaaatcttcttcaca |
20477081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 340
Target Start/End: Original strand, 20477106 - 20477150
Alignment:
| Q |
296 |
tttatatttacccgatgattgttgggaatctatcttcaaattcat |
340 |
Q |
| |
|
||||||||||||||| || |||||||||||||| ||||||||||| |
|
|
| T |
20477106 |
tttatatttacccgacgactgttgggaatctattttcaaattcat |
20477150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 300 - 350
Target Start/End: Original strand, 17206970 - 17207020
Alignment:
| Q |
300 |
tatttacccgatgattgttgggaatctatcttcaaattcattatcaacaac |
350 |
Q |
| |
|
||||||| ||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
17206970 |
tatttactagatgaatgttggaaatctatcttcaaattcatcatcaacaac |
17207020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 301 - 363
Target Start/End: Original strand, 53759968 - 53760030
Alignment:
| Q |
301 |
atttacccgatgattgttgggaatctatcttcaaattcattatcaacaacaatgacgaaaaca |
363 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||| || | ||||||||||| ||| |||||| |
|
|
| T |
53759968 |
atttacctgatgagtgctgggaatctatcttcaaactcgtcatcaacaacaaggacaaaaaca |
53760030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 345
Target Start/End: Original strand, 1547373 - 1547418
Alignment:
| Q |
300 |
tatttacccgatgattgttgggaatctatcttcaaattcattatca |
345 |
Q |
| |
|
|||||||| || || |||||||||||||||||||||||||| |||| |
|
|
| T |
1547373 |
tatttacctgacgagtgttgggaatctatcttcaaattcatcatca |
1547418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 315 - 349
Target Start/End: Original strand, 51763081 - 51763115
Alignment:
| Q |
315 |
tgttgggaatctatcttcaaattcattatcaacaa |
349 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
51763081 |
tgttgggaatctatcttcaaattcatcatcaacaa |
51763115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 10616247 - 10616194
Alignment:
| Q |
299 |
atatttacccgatgattgttgggaatctatcttcaaattcattatcaacaacaa |
352 |
Q |
| |
|
||||||||| ||||| |||||||||| |||||||||||| || |||||||||| |
|
|
| T |
10616247 |
atatttacctgatgagtgttgggaatgtatcttcaaatttatattcaacaacaa |
10616194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University