View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1394_high_12 (Length: 411)
Name: NF1394_high_12
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1394_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 152 - 314
Target Start/End: Original strand, 42980663 - 42980811
Alignment:
| Q |
152 |
cttacttgacaactgaataagcaggattgtcttgcaatggattagaatatgtctgggaaacnnnnnnnnntaatacaaatatttcatttcttcatgaaag |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
42980663 |
cttacttgacaactgaataagcaggattgtcttgcaatggattagaatatgtctgcgaa--------------tacaaatatttaatttcttcatgaaag |
42980748 |
T |
 |
| Q |
252 |
tttaattcaatacatagaatgaatgatacataagctaagctatgaagagaagaaacaggtttt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42980749 |
tttaattcaatacatagaatgaatgatacataagctaagctatgaagagaagaaacaggtttt |
42980811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 42980521 - 42980594
Alignment:
| Q |
10 |
aagaatatataaccttttgaggaacactgtcatcgatatgcacgaaatattgcctgacaagaggaaattaaatg |
83 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42980521 |
aagaaaatataaccttttgaggaacactgtcatcgatatgcacgaaatattgcctgaaaagaggaaattaaatg |
42980594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 155 - 206
Target Start/End: Complemental strand, 34225426 - 34225375
Alignment:
| Q |
155 |
acttgacaactgaataagcaggattgtcttgcaatggattagaatatgtctg |
206 |
Q |
| |
|
|||| |||||||| |||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
34225426 |
actttacaactgagtaagcagggttgtcttgcaaaggattaggatatgtctg |
34225375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 14 - 66
Target Start/End: Complemental strand, 51581934 - 51581882
Alignment:
| Q |
14 |
atatataaccttttgaggaacactgtcatcgatatgcacgaaatattgcctga |
66 |
Q |
| |
|
||||| |||||| |||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
51581934 |
atatagaaccttctgaggaacggtgtcatccatatgcacgaaatactgcctga |
51581882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University