View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1394_high_40 (Length: 247)

Name: NF1394_high_40
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1394_high_40
NF1394_high_40
[»] chr4 (1 HSPs)
chr4 (30-225)||(54473647-54473842)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 30 - 225
Target Start/End: Complemental strand, 54473842 - 54473647
Alignment:
30 catttgaccttccataaaacaaagagaaagcttcgcctgaattgggaagttgagagggtgggtagttggagagacagcggaggaaggttcttctgagaga 129  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||    
54473842 catttgaccttccataaaacaaagagaaagcttcgcctaaattgggaagttgagagggtgggtagttggagagacggcggaggaaggttcttcagagaga 54473743  T
130 tattcaatggaatcggcggtggagagaatgctagtttatgatcggggagagtgacaaaggggatgtcgagagcttaggtgttttggaaatactatg 225  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54473742 tattcaatggaatcgacggtggagagaatgctagtttatgatcggggagagtgacaaaggggatgtcgagagcttaggtgttttggaaatactatg 54473647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University