View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1394_high_44 (Length: 216)

Name: NF1394_high_44
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1394_high_44
NF1394_high_44
[»] chr6 (1 HSPs)
chr6 (53-186)||(2151063-2151196)


Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 53 - 186
Target Start/End: Original strand, 2151063 - 2151196
Alignment:
53 gtctgacaccaacaacatgtttaccttcaattaattgatgttctaaaattattattagtgttggtattgtgtaagtatgatatgtttaaggtaacaaaaa 152  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2151063 gtctgacaccgacaacatgtttaccttcaattaattgatgttctaaaattattattagtgttggtattgtgtaagtatgatatgtttaaggtaacaaaaa 2151162  T
153 tgaatgagaggctgattgtgttatagtattatct 186  Q
    ||||||||||||||||||||||||| ||||||||    
2151163 tgaatgagaggctgattgtgttataatattatct 2151196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University