View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1394_high_46 (Length: 216)
Name: NF1394_high_46
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1394_high_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 53 - 186
Target Start/End: Original strand, 2151063 - 2151196
Alignment:
| Q |
53 |
gtctgacaccaacaacatgtttaccttcaattaattgatgttctaaaattattattagtgttggtattgtgtaagtatgatatgtttaaggtaacaaaaa |
152 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2151063 |
gtctgacaccgacaacatgtttaccttcaattaattgatgttctaaaattattattagtgttggtattgtgtaagtatgatatgtttaaggtaacaaaaa |
2151162 |
T |
 |
| Q |
153 |
tgaatgagaggctgattgtgttatagtataatct |
186 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||| |
|
|
| T |
2151163 |
tgaatgagaggctgattgtgttataatattatct |
2151196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University