View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1394_low_17 (Length: 404)

Name: NF1394_low_17
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1394_low_17
NF1394_low_17
[»] chr6 (1 HSPs)
chr6 (84-218)||(7383592-7383725)


Alignment Details
Target: chr6 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 84 - 218
Target Start/End: Complemental strand, 7383725 - 7383592
Alignment:
84 attatactcaaagttttaaattgcattctctgttgacattatgaatgaaattatggtcgtaaggtcaagttttttatgcttgtgcaatctcattgcactt 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
7383725 attatactcaaagttttaaattgcattctctgttgacattatgaatgaaattatggtcgtaaggt-aagttttttatgcttgtgcaatctcattgcactt 7383627  T
184 gtaaatttggccacattagtcgaattttcacaaat 218  Q
    |||||||||||||||||||||||||||||||||||    
7383626 gtaaatttggccacattagtcgaattttcacaaat 7383592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University