View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1394_low_17 (Length: 404)
Name: NF1394_low_17
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1394_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 84 - 218
Target Start/End: Complemental strand, 7383725 - 7383592
Alignment:
| Q |
84 |
attatactcaaagttttaaattgcattctctgttgacattatgaatgaaattatggtcgtaaggtcaagttttttatgcttgtgcaatctcattgcactt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7383725 |
attatactcaaagttttaaattgcattctctgttgacattatgaatgaaattatggtcgtaaggt-aagttttttatgcttgtgcaatctcattgcactt |
7383627 |
T |
 |
| Q |
184 |
gtaaatttggccacattagtcgaattttcacaaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7383626 |
gtaaatttggccacattagtcgaattttcacaaat |
7383592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University