View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1394_low_38 (Length: 297)
Name: NF1394_low_38
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1394_low_38 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 29 - 297
Target Start/End: Original strand, 19597474 - 19597739
Alignment:
| Q |
29 |
ggtagctccgttaaagattgcgttcttcttcgcaggaatgaaaatggccttggtggcagtgaagattgatgtggctgcagtgaagatggtggtttctctg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19597474 |
ggtagctccgttaaagattgcgttcttcttcgcaggaatgaaaacggccttcgtggcaatgaagattgctgtggctgcagtgaagatggtggtttctctg |
19597573 |
T |
 |
| Q |
129 |
atgaagaaggtagtggtttctttgatgaagatggtggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaaga |
228 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597574 |
atgaaga---tagtgggttctttgatgaagatggtggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaaga |
19597670 |
T |
 |
| Q |
229 |
tggtggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaaga |
297 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597671 |
tggcggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaaga |
19597739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 136 - 297
Target Start/End: Original strand, 19597647 - 19597811
Alignment:
| Q |
136 |
aggtagtggtttctttgatgaagatggtggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaagatggtggt |
235 |
Q |
| |
|
|||| |||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597647 |
aggtggtggattcttggatgaagatggcggtgcattagaatcggatagttttggtggcggtggtggaggaggtggtggattcttggatgaagatggtggt |
19597746 |
T |
 |
| Q |
236 |
gcattagaatcggatagttt---tggtggcggtggtggaggaggtggtggattcttggatgaaga |
297 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
19597747 |
gcattagaatcggatagttttggtggtggtggtggtggaggaggtggtgggttctttgatgaaga |
19597811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 136 - 276
Target Start/End: Original strand, 19597716 - 19597859
Alignment:
| Q |
136 |
aggtagtggtttctttgatgaagatggtggtgcattagaatcggatagttttggtggcggtg---gtggaggaggtggtggattcttggatgaagatggt |
232 |
Q |
| |
|
|||| |||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||| |||||||||||| |
|
|
| T |
19597716 |
aggtggtggattcttggatgaagatggtggtgcattagaatcggatagttttggtggtggtggtggtggaggaggtggtgggttctttgatgaagatggt |
19597815 |
T |
 |
| Q |
233 |
ggtgcattagaatcggatagttttggtggcggtggtggaggagg |
276 |
Q |
| |
|
||||||| ||||| || | |||||||||| ||||| || ||||| |
|
|
| T |
19597816 |
ggtgcatcagaattgggtggttttggtggtggtggagggggagg |
19597859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University