View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1394_low_43 (Length: 283)

Name: NF1394_low_43
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1394_low_43
NF1394_low_43
[»] chr1 (1 HSPs)
chr1 (159-210)||(47385962-47386013)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 159 - 210
Target Start/End: Complemental strand, 47386013 - 47385962
Alignment:
159 attacttcaccaaccatttcattttcatataattcttcttctttattttgtg 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||    
47386013 attacttcaccaaccatttcattttcatataattcttcttctttattatgtg 47385962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University