View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1394_low_56 (Length: 249)
Name: NF1394_low_56
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1394_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 30 - 225
Target Start/End: Complemental strand, 54473842 - 54473647
Alignment:
| Q |
30 |
catttgaccttccataaaacaaagagaaagcttcgcctgaattgggaagttgagagggtgggtagttggagagacagcggaggaaggttcttctgagaga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
54473842 |
catttgaccttccataaaacaaagagaaagcttcgcctaaattgggaagttgagagggtgggtagttggagagacggcggaggaaggttcttcagagaga |
54473743 |
T |
 |
| Q |
130 |
tattcaatggaatcggcggtggagagaatgctagtttatgatcggggagagtgacaaaggggatgtcgagagcttaggtgttttggaaatactatg |
225 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473742 |
tattcaatggaatcgacggtggagagaatgctagtttatgatcggggagagtgacaaaggggatgtcgagagcttaggtgttttggaaatactatg |
54473647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University