View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1394_low_59 (Length: 228)
Name: NF1394_low_59
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1394_low_59 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 38280774 - 38280989
Alignment:
| Q |
7 |
tcgtcgtctacttcaagttctagatacaactttcttaaatgaagagaagtgtttctaagagtaaacacgctttgattctaattgtaagtacaaggagata |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38280774 |
tcgtcgtctacttcaagttctagataccactttcttaaatgaagagaagtgtttctaagagtaaacacgctttgattctaattgtaagtacaaggagata |
38280873 |
T |
|
| Q |
107 |
gtcacaggtaagattaaagaactctgttatttttggaactttcttaattagtacgcgcttctagatactttattcacttgtgtacattgtaatgtacttc |
206 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
38280874 |
gtcacaggtaaaattaaagaactctgttatttttggaactttcttaattagtacacacttctagatattttattcacttgtgtacatt------tacttc |
38280967 |
T |
|
| Q |
207 |
tagatatttcatgagattttct |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38280968 |
tagatatttcatgagattttct |
38280989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University