View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1394_low_62 (Length: 219)
Name: NF1394_low_62
Description: NF1394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1394_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 75 - 210
Target Start/End: Complemental strand, 25529053 - 25528919
Alignment:
| Q |
75 |
gctaataatcacctataatgtttctagaaaatagacaaacaacaagaaaaaagttagaatataagctagccaattttgtctatttccccccnnnnnnncc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
25529053 |
gctaataatcacctataatgtttctagaaaatagacaaacaacaagaaaaaagttagaatataagctagccaattttgtctatttc-ccccaaaaaaacc |
25528955 |
T |
 |
| Q |
175 |
aacaatgaacaaaataaaaattgaacggagtattat |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25528954 |
aacaatgaacaaaataaaaattgaatggagtattat |
25528919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University