View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13950_high_1 (Length: 437)
Name: NF13950_high_1
Description: NF13950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13950_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 19 - 424
Target Start/End: Complemental strand, 43452265 - 43451860
Alignment:
| Q |
19 |
tctactacggccatctcagtaagagtcacagtggatgggtttaggacatacagtagcacaacagcttctgtcaaccctttcttgaaaagagccattatac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452265 |
tctactacggccatctcagtaagagtcacagtggatgggtttaggacatacaatagcacaacagcttctgtcaaccctttcttgaaaagagccattatac |
43452166 |
T |
 |
| Q |
119 |
attcaacgtcggtatccacgcgtgttagagtctgaataacagaattgtctctagatcccatctcagccagaaggaaaactgctgcctgaagaacctgggg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452165 |
attcaacgtcggtatccacgcgtgttagagtctgaataacagaattgtctctagatcccatctcagccagaaggaaaactgctgcctgaagaacctgggg |
43452066 |
T |
 |
| Q |
219 |
ttcaacagaattgaaaagtatctccacaaacccattaataattggaggttttgatagcatgctgtggatatccactcccagattccctcctctccacaac |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43452065 |
ttcaacagaattgaaaagtatctccacaaacccattaataattggaggttttgatagcatgctgtggatatccactcccagattccctcctctccacaat |
43451966 |
T |
 |
| Q |
319 |
ttctctatttgaagagccgccatttcagattcctggagaatctctgacatgtacaggttattgattgcacagcgtaactcgccaatcatcccatcaacag |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43451965 |
ttctctatttgaagagccgccatttcagattcctggagaatctctgacatgtacaggttattgattgcacagcgtaactcgccaatcatcccatcaacag |
43451866 |
T |
 |
| Q |
419 |
tggcct |
424 |
Q |
| |
|
|||||| |
|
|
| T |
43451865 |
tggcct |
43451860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University