View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13951_high_13 (Length: 229)

Name: NF13951_high_13
Description: NF13951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13951_high_13
NF13951_high_13
[»] chr2 (1 HSPs)
chr2 (21-207)||(44687875-44688061)


Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 44687875 - 44688061
Alignment:
21 ggcatggcatgggcccactaatccatccaataatgtcaaacgtgtctatgaggcagagctcgtaaggaatgatcaaaatgggcaaaggatttatacccgc 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
44687875 ggcatggcatgggcccactaatccatccaataatgtcaaacgtgtctatgaggcagagctcgaaaggaatgatcaaaatgggcaaaggatttatacccgc 44687974  T
121 aaaaactacaatacctaggataacctaggataagtgaagtaaatatcttaattttgcattaaaatttgaccaatacaagtgctggta 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44687975 aaaaactacaatacctaggataacctaggataagtgaagtaaatatcttaattttgcattaaaatttgaccaatacaagtgctggta 44688061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University