View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13951_high_14 (Length: 228)
Name: NF13951_high_14
Description: NF13951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13951_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 45708034 - 45708217
Alignment:
| Q |
16 |
acctttggactaaagagtggtaatttgcttggccagttggccaattgtt-acaccatatattttctacattagatgccctaaagaagagaaaatcactag |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
45708034 |
acctatggactaaagagtggtaatttgcttggccagttgtccaatttttcacaccatatattttctacattggatgccctaaagaagagaaaatcacgag |
45708133 |
T |
 |
| Q |
115 |
aatggaaaaataaagactgagaaggctttagnnnnnnnccagagaaagatgataaagaatttgaaagttactactattctttgat |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
45708134 |
aatggaaaaataaagacagagaaggctttag-ttttttccagagaaagatggtaaagaattggaaagttactactattctttgat |
45708217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University