View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13951_low_13 (Length: 254)
Name: NF13951_low_13
Description: NF13951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13951_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 52237540 - 52237661
Alignment:
| Q |
1 |
caataaataatgatcacaaatacaaagaaaattaagagacagaaaaagttgatacagagagaccagcttgaactctgttgccgtgcatttcctgtagata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52237540 |
caataaataatgatcacaaatacaaagaaaattaagagacagaaaaagttgatacagagagaccagcttgaactctgttgccgtgcatttcctgtagata |
52237639 |
T |
|
| Q |
101 |
tatttactgtgctaatacataa |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52237640 |
tatttactgtgctaatacataa |
52237661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 159 - 244
Target Start/End: Original strand, 52237703 - 52237788
Alignment:
| Q |
159 |
gatgacttctatattattcggcaaaaaatgctttgtatgcacacctgagtgaagtcactcatttatatattttttcaatgaaatta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52237703 |
gatgacttctatattattcggcaaaaaatgctttgtatgcacacctgagtgaagtcactcatttatatattttttcaatgaaatta |
52237788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University