View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13951_low_15 (Length: 229)
Name: NF13951_low_15
Description: NF13951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13951_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 44687875 - 44688061
Alignment:
| Q |
21 |
ggcatggcatgggcccactaatccatccaataatgtcaaacgtgtctatgaggcagagctcgtaaggaatgatcaaaatgggcaaaggatttatacccgc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44687875 |
ggcatggcatgggcccactaatccatccaataatgtcaaacgtgtctatgaggcagagctcgaaaggaatgatcaaaatgggcaaaggatttatacccgc |
44687974 |
T |
|
| Q |
121 |
aaaaactacaatacctaggataacctaggataagtgaagtaaatatcttaattttgcattaaaatttgaccaatacaagtgctggta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44687975 |
aaaaactacaatacctaggataacctaggataagtgaagtaaatatcttaattttgcattaaaatttgaccaatacaagtgctggta |
44688061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University