View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13951_low_17 (Length: 227)
Name: NF13951_low_17
Description: NF13951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13951_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 40114131 - 40114315
Alignment:
| Q |
17 |
gaacagatgcatggtaaagtttctttggtttgaatatgttgttttgggatctagtaaccacatgattgcgatcattagcacctgcaatggggttaggtag |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40114131 |
gaacagatgcatggtaaagtttctttgttttgaatatgttgttttgggatctagtgaccacatgattgcgatcattagcacctgcaatggggttaggtag |
40114230 |
T |
 |
| Q |
117 |
aatcataggtaggtttaaagtagaagatgtagtgggcagattattacctgatgaagaacttgagtgcaaggttgcctcttgagga |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40114231 |
aatcataggtaggtttgaagtagaagatgtagtgggcagattattacctgatgaagaacttgagtgcaaggttgcctcttgagga |
40114315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 92
Target Start/End: Original strand, 655275 - 655327
Alignment:
| Q |
40 |
tttggtttgaatatgttgttttgggatctagtaaccacatgattgcgatcatt |
92 |
Q |
| |
|
|||||||| || ||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
655275 |
tttggtttaaagatgttgttttgagatctagtaacaacatgatagcgatcatt |
655327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University