View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13952_high_8 (Length: 235)
Name: NF13952_high_8
Description: NF13952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13952_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 8332178 - 8332401
Alignment:
| Q |
1 |
aataagcatataaattcaatgaagggtagtgaaactgaaatctctctcaaaccatcccaaaaaactatgtcttcatctt---cttcttcttctcctagta |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8332178 |
aataagcatataaattcaatgaagggtagtgaaactgaaatctctctcaaaccatcccaaaaaactatgtcttcatcttcttcttcttcttctcctagta |
8332277 |
T |
 |
| Q |
98 |
gcggagttgtggacactaacccttcacaaccttctgatgtgcgaacttttcgccgccgtttagattctcatcagactcccgagatgagcctaaaagcacc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
8332278 |
gcggagttgtggacactaacccttcacaaccttctgatgtgccaatttttcgccgccgtttagattctgatcagactccagagatgagtctaaaagcacc |
8332377 |
T |
 |
| Q |
198 |
tgtggtgagaccttatgttcgatc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8332378 |
tgtggtgagaccttatgttcgatc |
8332401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University