View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13952_low_6 (Length: 250)
Name: NF13952_low_6
Description: NF13952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13952_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 8331876 - 8332116
Alignment:
| Q |
10 |
aagaatatgatatctcaaagacttctgccccattcacctttttaacctttcattttcaccaatcatgaagacatttttgaacannnnnnnccttcagagt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
8331876 |
aagaaaatgatatctcaaagacttctgccccattcacctttttaacctttcattttcaccaatcatgaaggcatttttgaacatttttttccttcagagt |
8331975 |
T |
|
| Q |
110 |
ttcagtgtcagaaattttccatttatccatcgaaactctttaggactaaattgaccctttgggcacaaaaaagctgcactaaacgacaagcattttctgc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8331976 |
ttcagtgtcagaaattttccatttatccatcgaaactctttaggactaaattgaccatttgggcacaaaaaagctgcactaaacgacaagcattttctgc |
8332075 |
T |
|
| Q |
210 |
tgtataacgttacttagtatttattctcttttgtttcttca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8332076 |
tgtataacgttacttagtatttattctcttttgtttcttca |
8332116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University