View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13953_high_3 (Length: 429)
Name: NF13953_high_3
Description: NF13953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13953_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-165; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 13 - 353
Target Start/End: Complemental strand, 33228755 - 33228418
Alignment:
| Q |
13 |
gcagagatgatgttggagacaaggttgaaaagggtatctctatcatatttctcattatcattgacatgggtgagataaactttgttaaggatatcaatat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33228755 |
gcagagatgatgttggagacaaggttgaaaagggtatccctatcatatttcatattatcattgacatgggtgagataaactttgttaaggatttcaatat |
33228656 |
T |
|
| Q |
113 |
cctcaagcttaaagggattagggagctgagatttctgttgttgggaggtatcattcttttgggtcgtagtgccactgattggtacattataggaggacaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33228655 |
cctcaagcttaaagggattagggagctgagatttctgttgttgggaggtatcattcttttgggtcgtagtgccactgattggtacattat---aggacaa |
33228559 |
T |
|
| Q |
213 |
tgcagtggacatggtgatgatttgtttataaattaataagatttgatataagtaattagcaaattaattatctcaccttgcttaatttctgctaggtgct |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33228558 |
tgcagtggacatggtgatgatttgtttataaattaataagatttgatataagtaattaggaaattaattatctcaccttgcttaatttctgataggtgct |
33228459 |
T |
|
| Q |
313 |
tcccctatttatacttgacatgtttaatagacaaatatttc |
353 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33228458 |
tcctctatttatacttgacatgtttaacagacaaatatttc |
33228418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 411
Target Start/End: Complemental strand, 33228388 - 33228360
Alignment:
| Q |
383 |
caaggtagcttcttcattagtggtctata |
411 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33228388 |
caaggtagcttcttcattagtggtctata |
33228360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University