View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13953_high_4 (Length: 325)
Name: NF13953_high_4
Description: NF13953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13953_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 153 - 318
Target Start/End: Original strand, 32327017 - 32327181
Alignment:
| Q |
153 |
cactgcactccctcaa-gtgaaaatttcataggaggggatccgtttccagtaatacactggtaaggacaatcatgtagcaattattaatgtacattttct |
251 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32327017 |
cactgcactcccacaaagtgaaaatttcataggaggggatccgtttccagtaatacacaggtaaggacaatcatgtagcaattattaatgtacattttct |
32327116 |
T |
|
| Q |
252 |
tatggtgtgtttggatctatagaaaccacgacaactgcaaaaccacgttctaatgtcatattcttcg |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
32327117 |
tatggtgtgtttggatc--tagaaaccacgacaactgcaaaaccgcattctaatgtcatatttttcg |
32327181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 19 - 130
Target Start/End: Original strand, 32322215 - 32322319
Alignment:
| Q |
19 |
ataactgctttcatgatatagtaaaacacggttccggattttctccctcaaccggagaagtgagaacccagtgaaatccgagctacttttttcccacgac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32322215 |
ataactgctttcatgatatagtaaaacacggttccggattttctccatcaaccg-------gagaacccagtgaaatccgagctacttgtttcccacgac |
32322307 |
T |
|
| Q |
119 |
cgaatgtacaca |
130 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
32322308 |
cgaacgtacaca |
32322319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University