View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13953_low_5 (Length: 280)
Name: NF13953_low_5
Description: NF13953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13953_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 13136103 - 13136062
Alignment:
| Q |
11 |
atcatcactcaactgaatttacaattgttgaaaccttttccc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13136103 |
atcatcactcaactgaatttacaattgttgaaaccttttccc |
13136062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 164
Target Start/End: Complemental strand, 13135979 - 13135949
Alignment:
| Q |
134 |
tagttcaaaaacactaatgcattacccaaat |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13135979 |
tagttcaaaaacactaatgcattacccaaat |
13135949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 263
Target Start/End: Complemental strand, 13135882 - 13135854
Alignment:
| Q |
235 |
tagacaatgtaattgaaatgagtcattct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13135882 |
tagacaatgtaattgaaatgagtcattct |
13135854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 179
Target Start/End: Complemental strand, 55209376 - 55209336
Alignment:
| Q |
140 |
aaaaacactaatgcatt-acccaaattattaactagctagt |
179 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
55209376 |
aaaaacactaatgcattaaccaaaattattaactagctagt |
55209336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University